Hi,
I am trying to confirm daf-16 deletion in mgDf47 allele, can anyone tell me what the exact site of deletion is? and what primers they used to confirm it by sequencing?
Thank you
WormBase says it’s a 20193 bp deletion with the sequence TCTTCATTTTCAG inserted at the site of the deletion. The precise location and flanking sequences are at the link.
The link is a page about mgDf50?
I don’t know the exact site (maybe ~7.5 kb deletion beginning after exon 4?), but
the mix of the following three primers is used in our lab. The PCR product sizes
are ~450 bp for WT and ~600 bp for mgDf47.
GAGAGAAATAGAATGAAAAGAAAGAGAGGTAGAG
CTGAAAACATGTGATCTTACGAATTTCGATGC
GAGTAGCTGCAGCCGTCTGTCTCA
whoops, somehow between reading the post and going to WormBase I misremembered which allele.
Thank you for your responses.
@mikan- is GAGAGAAATAGAATGAAAAGAAAGAGAGGTAGAG an insertion in the mutant? I cant find it in the unspliced R13H8.1b sequence on wormbase.
@joan3011
I have found GAGAGAAATAGAATGAAAAGAAAGAGAGGTAGAG is located 1430–1464 bp after the stop codon of R13H8.1b in the opposite direction.