GFP or mCherry insertion at cxTi10882 IV for balancing?

Does anyone know of an insertion at the cxTi10882 IV mos site with myo-2 or myo-3 (or anything clearly visible in a dissecting scope) promoters driving either mCherry or GFP? I am making insertions at both the LGII and LGIV sites using the Jorgensen MosSCI approach. There is a nice insertion of Pmyo-2::mCherry::H2B Pmyo-3::mCherry::H2B that balances a user-generated insertion on LGII but they don’t list one for LGIV. There is an insertion at LGIV driven by a coelomocyte promoter but that is not visible in a dissecting scope.

Thanks for any help or tips for searching Wormbase for insertions at this locus.

Tim Kroft

Can you use nT1 marked with qIs51? It balances that site, and its myo-2::gfp marker gives strong expression.

I would be trying to cross my insertion on IV into a mutant background which is on LGV. The final desired genotype would be Si/Si IV; spe-42/spe-42 V. I use that nT1 strain to balance spe-42 on V but I think in this case the translocation on both IV and V would get in the way. Maybe I shouldn’t have used the word “balancer”. I’m looking for a fluorescent insertion at the LGIV site that I can use to follow my insertion which, presumably, won’t be visible in a dissecting scope. I have a Pmyo-2::GFP insertion on V that I use to follow my spe-42 alleles. By looking for worms that have neither the GFP / mCherry on IV and the GFP on V, I could be assured that I am picking worms of the desired genotype.

Instead of balancers, I use duplex PCR to follow inserts at the II and IV sites.

Mike Nonet developed long-range oligos for II, some of which I use in a duplex protocol. I applied a similar strategy for IV. Put all 3 oligos into one PCR reaction. Het’s will have 2 bands, homozygous wt and inserts will have one each at different sizes.

http://neuroscience.wustl.edu/nonetlab/ResourcesF/PCR%20of%20MosSCI%20transgenes.pdf

NM3887-fwd ACCGGAAACCAAAGGACGAGAG (upstream of II site)
cb-unc-119-rev CAATTCATCCCGGTTTCTGT (inside cb-unc-119 gene)
NM3888-rev ACGCCCAGGAGAACACGTTAG (downstream of II site)

Amplification of NM3887-fwd with cb-unc-119-rev should give a product of 535bp (with insert); amplification with NM3888-rev should give a product of 660bp (no insert, no Mos1).

KC0882(int)-fwd GAAGAACCCTGATTCTGTCAAG (upstream of IV site)
KC0882(int)-rev CATATCCGCCAAGGACGCTCC (downstream of IV site)

amplification of KC0882-fwd with cb-unc-119-rev should give a product of about 419bp (with insert); amplification with KCTi0882(int)-fwd should give a product of about 760 bp (no insert, no Mos1).

-Kevin.

If you read this thread about integrated transgenes, you will find some AQL query language in a comment by “Freddie” that will help you to find 117 transgenes Wormbase knows to be on LGIV, or you can look at list of mapped transgenes Igor put together, which includes data about construction and expression. Most of these mapped transgenes will probably express GFP or RFP, though some may have other undesirable traits. The only problem is, I doubt that most of these transgenes have been mapped well beyond demonstrating linkage to LGIV, or that they’ve been shown to balance your site of interest. The odds for any given transgene aren’t bad (you’re right at the middle of the chromosome, and a large proportion of integrated transgenes suppress recombination on at least part of the chromosome they’re integrated onto) - you could get hold of a bunch of these transgenes and test them for tight linkage to dpy-13. But that may be a hassle you’d prefer to avoid.

Thanks for all of the information. It looks like a good strategy will be to choose a LGIV transgene insertion as close to the site as possible and then use the PCR approach to make sure everything is as it should be in the final strain.

Tim Kroft

My lab has inserted myo-2p::mCherry into cxTi10882. We will send the strain (hjSi20) to CGC this week.

Ho Yi Mak