Hi,
I’m looking for a vector containing 1 or 2 NLS followed by Cherry sequence. Does anyone own such a NLS::Cherry plasmid? If yes, is it possible to get this plasmid?
Thank you,
Isabelle
I’m not sure what plasmids I can dig out with mCherry - I found mStrawberry worked better for me - and there is the Materials Transfer Agreement with the Tsien lab (I’d have to get permission to transfer the plasmid).
If you already have mCherry (or mStrawberry), you can make this yourself with one PCR, a digest, and a ligation. In the standard Fire vectors, the gfp coding sequence exists as a cassette between AgeI and EcoRI sites, with a short sequence before the start codon inside the cassette that resembles a C.elegans ribosome binding site, and another short sequence after the stop codon. Other aspects of the vector - frame, introns, NLS - are outside of this cassette. I designed primers based on this cassette, which have worked for me; their sequence (with some annotation) is below. Do the PCR with these primers from a plasmid with the mCherry cDNA, and clone into your favorite Fire vector using AgeI and EcoRI.
Primer name: mCherry.Fire.F
AgeI homology
AGAACCGGTAGAAAAAATGGTGAGCAAGGGCGAGG
Primer name: mCherry.Fire.R
EcoRI homology
CATGAATTCTACGAATGTTACTTGTACAGCTCGTCCATGC
I need an N2 or RC301 strain expressing the Cherry marker or any other fluorescent protein different from GFP? Doesn’t matter in which tissue. Please contact me.
Thank you,
The easiest way to do this is to find a paper with a strain that has what you are looking for. First check to see if the CGC has the strain. If they do, request it from them. If not conact the corresponding author on the paper and request the reagent (strain) that you need.
You can search the CGC collection for strains annotated with “rfp” or with “cherry”, and you’ll find a few transgenes that might be suitable.
I also searched for “strawberry” and for “tomato”, without result.
Thank you. I will try it.