Genbank format downloading from jbrowse1/2

As GBrowse is goinig to be retired January 2023, is there anyway to download directly genbank format from jbrowse? Genbank format can be edited with snapgene with gene feature. Manual adding feature to jbrowse sequencing waste too much time for me at present. It will be convenient if Jbrowse can download genbank format as well.

Hi, GenBank is a “janky” format and difficult to write correctly. I see that Snapgene supports GFF3 as well:

https://support.snapgene.com/hc/en-us/articles/10384245528212?input_string=gff3%3F

which JBrowse 1 will currently output and is a feature that is being worked on for JBrowse 2. Would that work?

Scott

Not Work. The coordinates are Inconsistent.
When I tried change coordinates with excel and save as a small gff, snapgene said my gff does not contain features.
Still not working. From snapgene link your provided, it seems that snapgene does not support join feature with gff3.
From my point of view, genebank format is irreplaceable.
Is it possible to output a most simplified genbank format like the link below?
https : / / cloud . tsinghua . edu . cn / f / a88b5244ef5643ddb5a0 / ? dl = 1

LOCUS       Exported                1699 bp DNA     linear   UNA 04-FEB-2023
FEATURES             Location/Qualifiers
     source          1..1699
     CDS             join(428..659,794..1099)
     CDS             complement(join(1278..1411,1515..1650))
ORIGIN
       1 ttaatttgaaatagtttccattttttgataataatgaaaagctgctgaaaaaatggtttggcagttagcaattccaggaattttttcgagataagccataaattttaaaattatggaaattgatttacgtgtgtttttttctaattctaaattttttggtgacgttttccacgttgatttatttatttttcgaacccccctttccctcaaccaaaatagtatttattcttcagtttcaatattgtcaaaaagctcgatgcccgagtattttgaatcttctgcgatttcaattagaagaaatgctgcaggaaacgacgttcaaaaggtaattgaaagcatttagaacatctcataaagatgatgtttcagaacaaagttcaaaattggcttcacagtgtgatcgagcgtctcaagtggtggagtcccggacgatgtcagcagctcttcgtcgagaatgagctcatcgagctatgctacagagctcgtgagcagttctggaaaaacaaagtgaagctagatgtacgtttagcgtatgagggattagcaattcattttctaataatttcagatcgaagctcctgtcaaaatctgtggagacattcacggacagttcgaggacttgatggctctgttcgagttgaatgggtggcctgaagagcataagtaagccgccaatttgaatttggattagtatatgttttcatttcagatatctctttcttggtgattatgttgaccgtggtccattctccattgaagtcatcacactcctcttcacctttcaaatattgatgcctgacaaagtcttccttcttcgaggaaaccacgaaagccgccccgtcaatatgcaatatggattttatctggaatgcaagaagcgctactcagtcgccttgtatgatgcatttcaacttgcattcaattgtatgccactgtgcgctgtcgtgagcaagaagatcatatgtatgcatggaggaatatctgaagatctgattgacttgacgtaagatctttttccaatttccttatgtacttcaacaaccaatttccagacaactcgaaaagattgatcgtccatttgatattccggacattggcgtcatctccgacttgacctgggctgatcccgacgagaaggtcttcggatatgccgattctccacgtggcgcgggacgttctttcggtccgaatgcggtcaagaagttccttcaaatgcacaacctggatctagtcgttcgtgcccatcaggtcgtcatggatggttatgaattctttgcggaccgccaacttgtcacagtcttctcggcaccatcatactgcggacaattcgacaatgctgctgccgtgatgaatgttgacgacaaattgctctgtactttcacaatcttccgcccggatttgaaagttggcgacttcaagaagaaggacaagtgatattttgatttatcgaaataaagcattttttgtaccgtcttgattttcaggttaggctcgaatcacgcgcgcctgcttctcgaccttaaaaatgcctccaggtacaccaggaggcgagcccgctaagcaagaattccagcgccttctcccttctctcccgcttcctgagaatattgatgacataatcggtattctttttgtgtgtgcctgtatccattattcacgcacacaagaacaccaacaagcatgctggttttcttatata
//