Hi!,
I wanted some help in identifying a robust NLS that works in C.elegans. I know the strain ccis4251 (pmyo-3::NLS-GFP), looks quite nice. Does anyone know the exact sequence of this or any other NLS?
Thank a lot!!!
Not sure…but seems you can try this:
http://cubic.bioc.columbia.edu/services/predictNLS/
Hope it helps,
Luv 
You might want to look at either of two previous threads in the forum: 1, 2.
I don’t know for certain with ccIs4251, but I strongly suspect it was made with the Fire vectors and contains the SV40NLS + LacZ fragment used in some of the Fire Vectors - it definitely contains an NLS and a LacZ fragment, as you can see at its transgene page or in the paper that first published it. In any case, the SV40 NLS used in the Fire vectors certainly works well (the LacZ fragment is there just to provide size and reduce diffusion out of the nucleus). The complete sequences of the Fire vectors are online, and although I’m not sure how well the sequences are annotated if you compare related versions - for example, with and without the SV40NLS-LacZ construct, or if you also compare to the 4xNLS constructs in a later version of the Fire Vector kit - you should readily be able to figure out what the localization signal is and how it was inserted in the plasmids.
I think the SV40 NLS in the Fire plasmid collection is reasonably well annotated. For example, I did a quick search for the NLS sequence in the pPD 93.65 vector and the sequence is ATGACTGCTCCAAAGAAGAAGCGTAAGGTACCGGTAGAAAAA
Good luck
Alternatively, if you simply want to force a fluoraphore to go to the nucleus many people tag H2B (his-58).