Hello everybody,
is anyone aware of a mut-16 mutation which have been found in many strains and prevent RNAi effect?
and if so do yuo have any ideas how I can check my strain with some primers?
Thank you a lot
Hi Silvia,
I have had success using these primers for mut-16(mg461) genotyping:
primer 1: aatattcgatcggcaagcag
primer 2: cccgccgatacagaaactaa
These amplify a 824 bp fragment in wild-type and a 373 bp fragment in mg461. PCR conditions: 55’ annealing (45s), 72’ extension (1 min), 35 cycles. These primers come from this worm breeder’s gazette article: http://www.wormbook.org/wbg/articles/volume-18-number-1/2-and-the-sins-of-the-fathers-are-visited-upon-the-children-an-rnai-deficient-mut-16mg461-allele-is-present-in-background-of-many-strains-possibly-derived-from-an-mrc-founder-effect/
Good Luck,
S
Thank you
I ll try that!
